View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2799_low_9 (Length: 294)
Name: NF2799_low_9
Description: NF2799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2799_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 51827005 - 51827157
Alignment:
| Q |
1 |
aggaaaccgtgcagaaagaatgaaaaataatgag---tataaaaaattgaggcagattggcctattgtcacggtaagatagatcactcaaggaaaaaacg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51827005 |
aggaaaccgtgcagaaagaatgaaaaataatgaggagtataaaaaattgaggcagattggcctattgtcacggtaagatagattactcaaggaaaaaacg |
51827104 |
T |
|
| Q |
98 |
ctattgtgaatacaatttatgattagagatcaaattcatacttatggaaatag |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51827105 |
ctattgtgaatacaatttatgattagagatcaaattcatactaatggaaatag |
51827157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 273
Target Start/End: Original strand, 51827264 - 51827300
Alignment:
| Q |
237 |
ttgaatttaagaatgacaaaaattagttacaggaata |
273 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51827264 |
ttgaatttaagaatgacaaaaattaattacaggaata |
51827300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University