View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2800R-Insertion-8 (Length: 263)
Name: NF2800R-Insertion-8
Description: NF2800R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2800R-Insertion-8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 9 - 263
Target Start/End: Original strand, 16808850 - 16809105
Alignment:
| Q |
9 |
ctttctgcttagcatttacttttaattgtctctattatggagaactaatggcttgtatttcaatctgtccataatgtggcatgcattggattggttaaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16808850 |
ctttctgcttagcatttacttttaattgtctctattatggagaactaatggcttgtatttcaatctgtccataatgtggcatgcattggattggtt-aaa |
16808948 |
T |
|
| Q |
109 |
atgctttgtcaaaagagataaggttaggctcagaatatcaaatttctggttattaaacactttgcaattc--caatagataaatattactccttcattat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16808949 |
atgctttgtcaaaagagataaggttaggctcagaatatcaaatttctggttattaaacactttgcaattccacaatagataaatattactccttcattat |
16809048 |
T |
|
| Q |
207 |
tttgacatttggatatgaaggattttgttctccatgtttatattatttaatgcacca |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16809049 |
tttgacatttggatatgaaggattttgttctccatgtttatattatttaatgcacca |
16809105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University