View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2800_low_1 (Length: 267)
Name: NF2800_low_1
Description: NF2800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2800_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 16808854 - 16809110
Alignment:
| Q |
1 |
ctgcttagcatttacttttaattgtctctattatggagaactaatggcttgtatttcaatctgtccataatgtggcatgcattggattggttaaaaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16808854 |
ctgcttagcatttacttttaattgtctctattatggagaactaatggcttgtatttcaatctgtccataatgtggcatgcattggattggtt-aaaatgc |
16808952 |
T |
|
| Q |
101 |
tttgtcaaaagagataaggttaggctcagaatatcaaatttctggttattaaacactttgcaattc--caatagataaatattactccttcattattttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16808953 |
tttgtcaaaagagataaggttaggctcagaatatcaaatttctggttattaaacactttgcaattccacaatagataaatattactccttcattattttg |
16809052 |
T |
|
| Q |
199 |
acatttggatatgaaggattttgttctccatgtttatattatttaatgcaccattcat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16809053 |
acatttggatatgaaggattttgttctccatgtttatattatttaatgcaccattcat |
16809110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University