View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2801_low_4 (Length: 364)
Name: NF2801_low_4
Description: NF2801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2801_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 20 - 301
Target Start/End: Complemental strand, 35576638 - 35576357
Alignment:
| Q |
20 |
taacataaccacatctctctcaatttcataatcacttcttcaccgcgatttctaaacgcgattatcgttatttctctgttcacacgattaattaacgtta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35576638 |
taacataaccacatctctctcaatttcataatcacttcttcaccgcgatttctaaacgcgattatcgttatttctctattcacacgattaattaacgtta |
35576539 |
T |
|
| Q |
120 |
aaacgattaatcaatctatcaaattatcttggaatcgattattgttatgggcgagttgactcaaacggaggtgtactcgccaccacgaactcaacaagtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35576538 |
aaacgattaatcaatctatcaaattatcttggaatcgattattgttatgggcgagttgactcaaacggaggtgtactcgccaccacgaactcaacaagtt |
35576439 |
T |
|
| Q |
220 |
tggaaatcacttttaagttggttcgcttttttctttcagatcttctctcagattattcgaacccttggtcactatcctttac |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35576438 |
tggaaatcacttttaagttggttcgcttttttctttcagatcttctctcagattattcgaacccttggtcactatcctttac |
35576357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University