View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2801_low_6 (Length: 249)
Name: NF2801_low_6
Description: NF2801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2801_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 109 - 237
Target Start/End: Original strand, 2021613 - 2021741
Alignment:
| Q |
109 |
ttaacttcattatcaattatgtgtgttat---tccgtatttatttcggttccattaaactatggaaaattttacatggttttctaacggatgaatatcct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2021613 |
ttaacttcattatcaattatgtgtgttattattccgtatttatttcggttccattaaactatggaaaattttacatggttttctaacggatgaata---t |
2021709 |
T |
|
| Q |
206 |
aatccaaaaaagatgaagaaaatatgaatatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2021710 |
aatccaaaaaagatgaagaaaatatgaatatt |
2021741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 110
Target Start/End: Complemental strand, 31178645 - 31178608
Alignment:
| Q |
73 |
acggtgcatcaattgttgacacatgaacaacacaagtt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31178645 |
acggtgcatcaattgttgacacatgaacatcacaagtt |
31178608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University