View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2802_low_7 (Length: 248)
Name: NF2802_low_7
Description: NF2802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2802_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 13744713 - 13744612
Alignment:
| Q |
110 |
tttggttgaattccggtaatcatattaatttgctagtcctgcagttctatgcatactaaaactcaggtaccagttacctatgattagcatatttcataca |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
13744713 |
tttggttgaattccagtaatca-attaatttgctagtcctacatttctatgcatactaaaactcaggtaccagttacctttggttagcatatttcataca |
13744615 |
T |
 |
| Q |
210 |
gct |
212 |
Q |
| |
|
||| |
|
|
| T |
13744614 |
gct |
13744612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 13744785 - 13744710
Alignment:
| Q |
14 |
atcatctgtataatcatcaatgaaaatatcagaacccacatgagatgctaaggtggaaggaacacacaataatttg |
89 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13744785 |
atcatctatataatcatcaataaaaatatcagatcccacaatagatgctaaggtggaaggaacacacaataatttg |
13744710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University