View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2802_low_8 (Length: 221)

Name: NF2802_low_8
Description: NF2802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2802_low_8
NF2802_low_8
[»] chr3 (4 HSPs)
chr3 (52-183)||(51942007-51942137)
chr3 (36-153)||(4582561-4582678)
chr3 (1-131)||(5155224-5155354)
chr3 (91-144)||(4614280-4614333)
[»] chr8 (2 HSPs)
chr8 (36-144)||(9677699-9677807)
chr8 (36-142)||(9693440-9693546)
[»] chr4 (3 HSPs)
chr4 (36-126)||(35160480-35160570)
chr4 (1-144)||(35154071-35154214)
chr4 (1-59)||(15555098-15555156)
[»] chr2 (1 HSPs)
chr2 (23-131)||(20154380-20154488)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 52 - 183
Target Start/End: Complemental strand, 51942137 - 51942007
Alignment:
52 atgctgagcacatcttgcagggacaatagcgaaaagacgatgttgttttctgattgttttgagaacaaatgtttggcgattctgagggaaactcgtgttt 151  Q
    |||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51942137 atgctgagcacaacttgcagagacaatggcgaaaagacgatgttgttttctgattgttttgagaacaaatgtttggcgattctgagggaaactcgtgttt 51942038  T
152 gggttgatcatgaagagacattgttcttacga 183  Q
     ||||| ||||| |||||||||||||||||||    
51942037 -ggttggtcatggagagacattgttcttacga 51942007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 36 - 153
Target Start/End: Original strand, 4582561 - 4582678
Alignment:
36 agagccagcagcgatcatgctgagcacatcttgcagggacaatagcgaaaagacgatgttgttttctgattgttttgagaacaaatgtttggcgattctg 135  Q
    ||||||||||||||||||||||||| || |||| || || | | | ||||| || ||||| || ||||||| ||||||||| | || |||||||||||||    
4582561 agagccagcagcgatcatgctgagcgcaacttggagcgaaagtggggaaaacacaatgttcttctctgattcttttgagaagagatatttggcgattctg 4582660  T
136 agggaaactcgtgtttgg 153  Q
    |||||||||  |||||||    
4582661 agggaaacttttgtttgg 4582678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 5155354 - 5155224
Alignment:
1 aggaagtctagaagttgctgccgtgtgggaccataagagccagcagcgatcatgctgagcacatcttgcagggacaatagcgaaaagacgatgttgtttt 100  Q
    |||||||| ||||| || ||  |||||||||| | ||||||||||||||| ||||| || ||| |||| || |||| | ||||||| || ||||| || |    
5155354 aggaagtcgagaagctgttgttgtgtgggaccctcagagccagcagcgatgatgcttagtacaacttgaagagacagtggcgaaaacacaatgttcttgt 5155255  T
101 ctgattgttttgagaacaaatgtttggcgat 131  Q
    || ||| |||  |||||| ||||||||||||    
5155254 ctaattctttcaagaacagatgtttggcgat 5155224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 144
Target Start/End: Original strand, 4614280 - 4614333
Alignment:
91 atgttgttttctgattgttttgagaacaaatgtttggcgattctgagggaaact 144  Q
    ||||| || ||||||| ||||||||| | |||||||||||||||||||||||||    
4614280 atgttcttctctgattcttttgagaaaagatgtttggcgattctgagggaaact 4614333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 36 - 144
Target Start/End: Original strand, 9677699 - 9677807
Alignment:
36 agagccagcagcgatcatgctgagcacatcttgcagggacaatagcgaaaagacgatgttgttttctgattgttttgagaacaaatgtttggcgattctg 135  Q
    ||||||||||||||| || ||||| ||| |||| || |||||| | |||||||||| |||||| ||||||| ||||||||| | |||||||||||   ||    
9677699 agagccagcagcgatgatactgagaacaacttggagagacaatggtgaaaagacgacgttgttgtctgattcttttgagaagagatgtttggcgaccgtg 9677798  T
136 agggaaact 144  Q
    |||||||||    
9677799 agggaaact 9677807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 36 - 142
Target Start/End: Original strand, 9693440 - 9693546
Alignment:
36 agagccagcagcgatcatgctgagcacatcttgcagggacaatagcgaaaagacgatgttgttttctgattgttttgagaacaaatgtttggcgattctg 135  Q
    ||||||| ||||||| |||||||| ||| |||| || |||||| | ||||||||||  || || ||||||| ||||||||| | ||||||||||||  ||    
9693440 agagccaacagcgatgatgctgagaacaacttggagagacaatggtgaaaagacgacattcttgtctgattcttttgagaagagatgtttggcgatggtg 9693539  T
136 agggaaa 142  Q
    |||||||    
9693540 agggaaa 9693546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 36 - 126
Target Start/End: Complemental strand, 35160570 - 35160480
Alignment:
36 agagccagcagcgatcatgctgagcacatcttgcagggacaatagcgaaaagacgatgttgttttctgattgttttgagaacaaatgtttg 126  Q
    ||||||||||| ||| |||||||||||| |||| || |||||| ||||||| |||||||| |||||||||| ||| ||||| | |||||||    
35160570 agagccagcagtgattatgctgagcacaacttggagagacaatggcgaaaacacgatgttcttttctgattctttggagaagagatgtttg 35160480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 35154214 - 35154071
Alignment:
1 aggaagtctagaagttgctgccgtgtgggaccataagagccagcagcgatcatgctgagcacatcttgcagggacaatagcgaaaagacgatgttgtttt 100  Q
    |||||||  ||||| || || ||||||| ||| | ||||||||||||||| ||    |||||  |||| || |||||  ||||||| ||||| || ||||    
35154214 aggaagttgagaagctgttgtcgtgtggaaccgtcagagccagcagcgatgattgcaagcactacttggagagacaaaggcgaaaacacgatattctttt 35154115  T
101 ctgattgttttgagaacaaatgtttggcgattctgagggaaact 144  Q
    ||||||  |||||||| | ||||||||||||  |||||||||||    
35154114 ctgattcctttgagaaaagatgtttggcgatagtgagggaaact 35154071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 15555156 - 15555098
Alignment:
1 aggaagtctagaagttgctgccgtgtgggaccataagagccagcagcgatcatgctgag 59  Q
    |||||||| |||||||| ||| |||||| ||| | ||||||||||||||| ||||||||    
15555156 aggaagtcgagaagttgttgctgtgtggaaccctcagagccagcagcgatgatgctgag 15555098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 131
Target Start/End: Complemental strand, 20154488 - 20154380
Alignment:
23 gtgtgggaccataagagccagcagcgatcatgctgagcacatcttgcagggacaatagcgaaaagacgatgttgttttctgattgttttgagaacaaatg 122  Q
    |||||||||| | ||||||||||||| | | ||||| |||| |||| || |||| | ||||||| || ||||| || |||||||||||  |||||| |||    
20154488 gtgtgggaccttcagagccagcagcggtgaggctgaacacaacttggagtgacactggcgaaaacacaatgttcttgtctgattgtttcaagaacagatg 20154389  T
123 tttggcgat 131  Q
    |||||||||    
20154388 tttggcgat 20154380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University