View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2803_high_2 (Length: 244)
Name: NF2803_high_2
Description: NF2803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2803_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 12 - 139
Target Start/End: Original strand, 44857291 - 44857418
Alignment:
| Q |
12 |
agatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagattttgtcacgagaatgtggtctgcatttgttgcatgaaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857291 |
agatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagattttgtcacgagaatgtggtctgcatttgttgcatgaaaca |
44857390 |
T |
 |
| Q |
112 |
gaaccatcttctagttcagtttcagaac |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44857391 |
gaaccatcttctagttcagtttcagaac |
44857418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 12 - 74
Target Start/End: Original strand, 37221725 - 37221787
Alignment:
| Q |
12 |
agatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagatttt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37221725 |
agatgaatacttgctgttactgttgctgttgttggaatgatcaaagggaaggataaagatttt |
37221787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University