View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_high_13 (Length: 243)
Name: NF2804_high_13
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 413341 - 413171
Alignment:
| Q |
18 |
aactccaacccatgtggtgcatatattcctaatggatggatagtgcaaacaatgaaaactggactcgacacgtatgtatctatatctagaggccagtgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
413341 |
aactccaacccatgtggtgcatatattcctaatggatggatggtgcaaacaatgaaaactggactcgacacgtatatatctatatctagaggccagtgtt |
413242 |
T |
|
| Q |
118 |
acatcaaattatcattaatggtaagcctgccattttcaagtttttctgaaaggatggatatttcttcatca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
413241 |
acatcaaattatcattaatggtaagcctgccattttcaagtttttctgaaaggatggatatttcttaatca |
413171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 243
Target Start/End: Complemental strand, 413165 - 413131
Alignment:
| Q |
209 |
actgttcgaatctggatatagatagacagcttttg |
243 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
413165 |
actgttcgaatctggatatagataaacagcttttg |
413131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University