View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2804_high_17 (Length: 227)

Name: NF2804_high_17
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2804_high_17
NF2804_high_17
[»] chr4 (1 HSPs)
chr4 (1-151)||(30804004-30804148)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 30804004 - 30804148
Alignment:
1 tctaaatattgagtatgtgtattgaaaaataaattgagtgctaaaatggtgacagaaacacttaggaccggtttgaacgagcaacttatttataacgcaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||      |    
30804004 tctaaatattgagtatgtgtattgaaaaataaattgagtgctaaaatggtgacaaaaacacttaagaccggtttgaatgagcaacttatttat------a 30804097  T
101 gcgcaagcgcttatgataatcgcttatgtatagttcatgtaacctatttct 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
30804098 gcgcaagcgcttatgataatcgcttatgtatagttcatgtaacctatttct 30804148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University