View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_high_9 (Length: 290)
Name: NF2804_high_9
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 99 - 241
Target Start/End: Original strand, 33117205 - 33117355
Alignment:
| Q |
99 |
ggattaccagcttaaaaaataagtggaatgaatatccacattgtgaatataaaattatgctactcaacatttggtaaattagagc--------tttcaca |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33117205 |
ggattaccagcttaaaaaataagtggaatgaatatccacattgtgaatataaaattatgctactcaacatttggtaaattagagctttcactgtttcaca |
33117304 |
T |
|
| Q |
191 |
tctcaaatatctaatcgttttgtctttttgttttcaatattctttattcac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117305 |
tctcaaatatctaatcgttttgtctttttgttttcaatattctttattcac |
33117355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 60
Target Start/End: Original strand, 33117131 - 33117163
Alignment:
| Q |
28 |
gtttatgactattttcttaggatctgcattaat |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33117131 |
gtttatgactattttcttaggatctgcattaat |
33117163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University