View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2804_low_10 (Length: 328)

Name: NF2804_low_10
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2804_low_10
NF2804_low_10
[»] chr7 (1 HSPs)
chr7 (20-315)||(15585806-15586100)
[»] chr4 (1 HSPs)
chr4 (183-228)||(14067783-14067828)


Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 315
Target Start/End: Original strand, 15585806 - 15586100
Alignment:
20 ctcgtgcattacacagatttcgccacaaatgccaaataggtgtggatagaacaacgtgcaccacttagagaaggaggttaaaccctaggtaaaaaaccac 119  Q
    |||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||  ||||||||||||||||||||||||||||||||    
15585806 ctcgtgaattacaccgatttcgccacaaatgccaaataggagtggatagaacaacgcgcaccacttgaagaaggaggttaaaccctaggtaaaaaaccac 15585905  T
120 agaatttcactgcatggtgtaatggcacagatnnnnnnntctctattcagtacaaactttcagtttcaacaggggaattccaacatacgctttggtaaga 219  Q
    ||||||||||||||||||||||||||||||||       |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
15585906 agaatttcactgcatggtgtaatggcacagataaaaaaatctctattcagtgcaaactttcagtttcaacaggggaattccaacatacgctttggtaaga 15586005  T
220 ttatagatttgatactaatgaaaatactgcaaaatctgacctgagattaaatatacggcagccatgtccgattgttggaatgtacaggctctccct 315  Q
    |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||    
15586006 ttatagatttgatactaatgaaaatactgc-aaatctgatctgagattaaatatacagcaaccatgtccgattgttggaatgtacaggctctccct 15586100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 228
Target Start/End: Complemental strand, 14067828 - 14067783
Alignment:
183 tttcaacaggggaattccaacatacgctttggtaagattatagatt 228  Q
    |||||| |||||||| | ||||||||| ||||||||||||||||||    
14067828 tttcaataggggaatccaaacatacgcattggtaagattatagatt 14067783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University