View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_10 (Length: 328)
Name: NF2804_low_10
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 315
Target Start/End: Original strand, 15585806 - 15586100
Alignment:
| Q |
20 |
ctcgtgcattacacagatttcgccacaaatgccaaataggtgtggatagaacaacgtgcaccacttagagaaggaggttaaaccctaggtaaaaaaccac |
119 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15585806 |
ctcgtgaattacaccgatttcgccacaaatgccaaataggagtggatagaacaacgcgcaccacttgaagaaggaggttaaaccctaggtaaaaaaccac |
15585905 |
T |
 |
| Q |
120 |
agaatttcactgcatggtgtaatggcacagatnnnnnnntctctattcagtacaaactttcagtttcaacaggggaattccaacatacgctttggtaaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15585906 |
agaatttcactgcatggtgtaatggcacagataaaaaaatctctattcagtgcaaactttcagtttcaacaggggaattccaacatacgctttggtaaga |
15586005 |
T |
 |
| Q |
220 |
ttatagatttgatactaatgaaaatactgcaaaatctgacctgagattaaatatacggcagccatgtccgattgttggaatgtacaggctctccct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15586006 |
ttatagatttgatactaatgaaaatactgc-aaatctgatctgagattaaatatacagcaaccatgtccgattgttggaatgtacaggctctccct |
15586100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 228
Target Start/End: Complemental strand, 14067828 - 14067783
Alignment:
| Q |
183 |
tttcaacaggggaattccaacatacgctttggtaagattatagatt |
228 |
Q |
| |
|
|||||| |||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
14067828 |
tttcaataggggaatccaaacatacgcattggtaagattatagatt |
14067783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University