View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_16 (Length: 247)
Name: NF2804_low_16
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 15585747 - 15585517
Alignment:
| Q |
1 |
tttggcttatcctcttgcatcctatcaattggtaaatgttgacactaatttgtcacttgggtaaaatttgaattaatttttatgagcggttgtgattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
15585747 |
tttggcttatcctcttgcatcctatcaattggtaaatgttaacactaatttgtcacttgggtaaaatttgaattattttttatgagcggttgtgattgat |
15585648 |
T |
 |
| Q |
101 |
ctgattggtactgtttcttcttcttttacctttgcagttggctataaatacttttcgaggttccacatgctcatcacttccactacagagcttttgttat |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
15585647 |
ctgattggtactgtttcttctgcttttacctttgcagttggctataaatacgttttgaggttccacatgctcatcacttccactgcagaacttttgttat |
15585548 |
T |
 |
| Q |
201 |
tctttcatctctttcatcccaatcctattat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15585547 |
tctttcatctctttcatcccaatcctattat |
15585517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 48 - 208
Target Start/End: Original strand, 14068117 - 14068278
Alignment:
| Q |
48 |
atttgtcacttgggtaaaatttgaattaatttt-tatgagcggttgtgattgctctgattggtactgtttcttcttcttttacctttgcagttggctata |
146 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| |||||||||||||| || || |||||| |||| ||||||| ||||||||| || |||||| ||||| |
|
|
| T |
14068117 |
atttgttacttgggtaaaatttgaattatttttttatgagcggttgtggttactttgattgttactatttcttcctcttttaccatttcagttgtctata |
14068216 |
T |
 |
| Q |
147 |
aatacttttcgaggttccacatgctcatcacttccactacagagcttttgttattctttcat |
208 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||||||||| || | |||||||| || |||||| |
|
|
| T |
14068217 |
aatacgtttggaggttccacatactcatcacttccactgcataacttttgttgttttttcat |
14068278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University