View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_19 (Length: 239)
Name: NF2804_low_19
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 16825269 - 16825452
Alignment:
| Q |
18 |
gaaagagtatatgcatatgtctccttcaaaatcagccaacaatgtcacaaattttatgggaacatcatttctacttgctctacttggtggtttcttgtct |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16825269 |
gaaagagtatatgcatatgtctccttctaaatcagccaacaatgtcacaaattttatgggaacatcatttctacttgctctacttggtggtttcttgtct |
16825368 |
T |
 |
| Q |
118 |
gatgcatttctcaccacttatcatgtctacttgataagtgcagttattgaactcatagtaagtcttctcattattattactacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16825369 |
gatgcatttctcaccacttatcatgtctacttgataagtgcagttattgaactcatagtaagtcttctcattattattactacc |
16825452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 43 - 167
Target Start/End: Complemental strand, 25177322 - 25177198
Alignment:
| Q |
43 |
tcaaaatcagccaacaatgtcacaaattttatgggaacatcatttctacttgctctacttggtggtttcttgtctgatgcatttctcaccacttatcatg |
142 |
Q |
| |
|
|||||||| || |||||||| |||||||| ||||||||| | ||||| |||||| | ||||||||||| || |||||||||||| |||| |||||||| |
|
|
| T |
25177322 |
tcaaaatctgctaacaatgtgacaaatttcatgggaacagcttttcttcttgctttgcttggtggttttttatctgatgcatttttcacaacttatcaca |
25177223 |
T |
 |
| Q |
143 |
tctacttgataagtgcagttattga |
167 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
25177222 |
tctacctgataagtgcagttattga |
25177198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University