View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_20 (Length: 237)
Name: NF2804_low_20
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 47 - 222
Target Start/End: Complemental strand, 11812231 - 11812053
Alignment:
| Q |
47 |
ttatgttggtgtatttttt-ggag--gttttatcttaacagaaattttatggtttattacacaacaaatcaattcagttcgaaaacatacagtattgttt |
143 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11812231 |
ttatcttggtgtattttttcggagatgttttatcttaacataaattttacggttcattacacaacaaatcaattcagttcgaaaacatacagttttgttt |
11812132 |
T |
 |
| Q |
144 |
tttgtaaaaattgttaaaatagttagaatataaattgagtttgttagtgagttaaagttcgttgctcactctagttagt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||| |
|
|
| T |
11812131 |
tttgtaaaaattgttaaaatagttagaatataaattgagttagttagtgagttaaagttctttactcactctagttagt |
11812053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University