View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_21 (Length: 227)
Name: NF2804_low_21
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 30804004 - 30804148
Alignment:
| Q |
1 |
tctaaatattgagtatgtgtattgaaaaataaattgagtgctaaaatggtgacagaaacacttaggaccggtttgaacgagcaacttatttataacgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||| | |
|
|
| T |
30804004 |
tctaaatattgagtatgtgtattgaaaaataaattgagtgctaaaatggtgacaaaaacacttaagaccggtttgaatgagcaacttatttat------a |
30804097 |
T |
 |
| Q |
101 |
gcgcaagcgcttatgataatcgcttatgtatagttcatgtaacctatttct |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804098 |
gcgcaagcgcttatgataatcgcttatgtatagttcatgtaacctatttct |
30804148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University