View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_6 (Length: 530)
Name: NF2804_low_6
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 222 - 523
Target Start/End: Original strand, 46932975 - 46933276
Alignment:
| Q |
222 |
cagttcacacccccctgactctttatctttctgtataatagtactctctaatattactactgcaatgtttcagcggctgacatggtgacagtacctatag |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46932975 |
cagttcacacccccctgactctttatctttctgtataatagtactctctaatattactactgcaatgtttcagcggctgacatggtgacagtacctatag |
46933074 |
T |
|
| Q |
322 |
tcctttatatttttctgattcatctgtgagtattactagtctcgtgaatccnnnnnnnnnnnnnnctgttctaaaacacttatttattaccactacctta |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46933075 |
tcctttatatttttctgattcatctgtgagtattactagtctcgtgaatccttttttgtttttttctgttctaaaacacttatttattaccactacctta |
46933174 |
T |
|
| Q |
422 |
ttcccttgttcatgttacgtgcatatttatgggaattgtatacannnnnnnnnnnnnnnatcttaatttaacaacaagacgaactaacccctctctgtgc |
521 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46933175 |
ttcccttgttcatgttacgtgcatatttatgggaattgtatacattttttaatttttttatcttaatttaacaacaagacgaactaacccctctctgtgc |
46933274 |
T |
|
| Q |
522 |
tc |
523 |
Q |
| |
|
|| |
|
|
| T |
46933275 |
tc |
46933276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 46932768 - 46932900
Alignment:
| Q |
18 |
tcaagtcccgataatcaaatgagaaagtgggaattattagtctagaaaacgtgaaggggaagaagaaaggaaaggaaaggaccaaaatgacaagtatctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46932768 |
tcaagtcccgataatcaaatgagaaagtgggaattattagtctagaaaacgtgaaggggaagaagaaaggaaaggaaaggaccaaaatgacaagtatctg |
46932867 |
T |
|
| Q |
118 |
gcaagttgtaaacaatcatgcatgcccttgttg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46932868 |
gcaagttgtaaacaatcatgcatgcccttgttg |
46932900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University