View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_8 (Length: 371)
Name: NF2804_low_8
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 9 - 356
Target Start/End: Complemental strand, 5173472 - 5173125
Alignment:
| Q |
9 |
agcagagatcaaagactcactacagaaagttaggctttggcttggaacattcgactcagccgaagaggcagctcgtgcttatgacactgctgctagagct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173472 |
agcagagatcaaagactcactacagaaagttaggctttggcttggaacattcgactcagccgaagaggcagctcgtgcttatgacactgctgctagagct |
5173373 |
T |
|
| Q |
109 |
ttgagaggtgctaatgcaagaaccaactttgaattgccagaatctgaaacaaatggtagtggaggttcaaagcgcggtgctggttccaaattcatgctag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173372 |
ttgagaggtgctaatgcaagaaccaactttgaattgccagaatctgaaacaaatggtagtggaggttcaaagcgcggtgctggttccaaattcatgctag |
5173273 |
T |
|
| Q |
209 |
agaatacagaacctttttcttttgaagatgtcagtgactcgggttcaggttcagaacacggtcttcttggtgcactcaaggcaaaactttttgacggaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173272 |
agaatacagaacctttttcttttgaagatgtcagtgactcgggttcaggttcagaacacggtcttcttggtgcactcaaggcaaaactttttgacggaaa |
5173173 |
T |
|
| Q |
309 |
agaagggaaattttcattttcatttccttctggtagcatggttacaaa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173172 |
agaagggaaattttcattttcatttccttctggtagcatggttacaaa |
5173125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University