View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2804_low_9 (Length: 365)
Name: NF2804_low_9
Description: NF2804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2804_low_9 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 236 - 365
Target Start/End: Original strand, 413018 - 413147
Alignment:
| Q |
236 |
aaatagatatgcctccaagttaattaggcagtgatttagcttaggagtactaaattgtataacataagtcgatgacggaagtacggagcatgaattgctg |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
413018 |
aaatagatatgcctccaagttaattaggcagtgatttagcttaagaggactaaattgtataacataaatcgatgacggaagtacggagcatgaattgttg |
413117 |
T |
|
| Q |
336 |
tctataattgcgacaaaagctgtctatcta |
365 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
413118 |
tctataattgcgacaaaagctgtttatcta |
413147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 8 - 115
Target Start/End: Original strand, 412011 - 412121
Alignment:
| Q |
8 |
gagcacagataagttgtcccctttt---ttgtcatggacttaaagttctatttcgttgaccaaattgagtcttctagtcggtgttaaggactaaaatgag |
104 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
412011 |
gagcacggataagttgtcccctttttttttgtcatggacttaaagttatatttcgttgaccaaattgagtcttctagtcgttgttaaggactaaaatgag |
412110 |
T |
|
| Q |
105 |
ttttcacttta |
115 |
Q |
| |
|
||||||||||| |
|
|
| T |
412111 |
ttttcacttta |
412121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 209
Target Start/End: Original strand, 412473 - 412501
Alignment:
| Q |
181 |
gcttgctcgtaagatatcataattagata |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
412473 |
gcttgctcgtaagatatcataattagata |
412501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University