View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2806_high_2 (Length: 426)
Name: NF2806_high_2
Description: NF2806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2806_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 111 - 259
Target Start/End: Complemental strand, 21254812 - 21254664
Alignment:
| Q |
111 |
gaattctgaaatcgaaggaaccttgaaattaaacaacgaagaagattccaatcaagaaaacaaacaaggagtgaagggaatccaaaccgaaatgaaatga |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
21254812 |
gaattctgaaattgaaggaaccttgaaattgaacaaggaagaagattccaatcaagaaaacaaacaagaagtgaaaggaatccaaacataaatgaaatga |
21254713 |
T |
|
| Q |
211 |
atttgctctgatgaaaggagaaacggaaatcctagaaattggggaaaat |
259 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
21254712 |
attttctctgatgaaagacgaaacggaaaccctagaaattgggaaaaat |
21254664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University