View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2806_low_10 (Length: 235)
Name: NF2806_low_10
Description: NF2806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2806_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 44750105 - 44750320
Alignment:
| Q |
11 |
cacagataattaccaatttgattcacaaactagaattctttcgttatcacttgcaagagaagaccaagaaatatatcaattaatcacaagaaaaggaagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750105 |
cacagataattaccaatttgattcacaaactagaattctttcgttatcacttgcaagagaagaccaagaaatatatcaattaatcacaagaaaaggaagg |
44750204 |
T |
 |
| Q |
111 |
ctccggtcaccggtggtggcaaaaagtttgaccttaaaacaaacccttgtttgtcccatgtgactatacaaaatgtacgaaacttcaaagatggtaccac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750205 |
ctccggtcaccggtggtggcaaaaagtttgaccttaaaacaaacccttgtttgtcccatgtgactatacaaaatgtacgaaacttcaaagatggtaccac |
44750304 |
T |
 |
| Q |
211 |
caatcacaaatttgta |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44750305 |
caatcacaaatttgta |
44750320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University