View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2807_high_14 (Length: 298)

Name: NF2807_high_14
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2807_high_14
NF2807_high_14
[»] chr3 (1 HSPs)
chr3 (1-275)||(48606598-48606872)


Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 48606598 - 48606872
Alignment:
1 gtgggtcaaagataatgagtaacgggaaccatgcttgtgtttgggttgaaattgaaatgaaacggaaagtggcagagagagattattatggaattatctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48606598 gtgggtcaaagataatgagtaacgggaaccatgcttgtgtttgggttgaaattgaaatgaaacggaaagtggcagagagagattattatggaattatctt 48606697  T
101 aaagtgagcgcaacgcaaaggggacaatgagctttacctgggtctgagtctgaatgatgcttcaacttcaaccatgatgatcagtgccatcggagatgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||    
48606698 aaagtgagcgcaacgcaaaggggacaatgagctttacctgggtctgagtctgagtgatgcttcaacttcaaccatgatgatcagtgtcatcggagatgat 48606797  T
201 gatgcttattctctctgaaacagggggaaccaatttcaaatattgaatcaatgtcattgtcatgtcatggaccct 275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48606798 gatgcttattctctctgaaacagggggaaccaatttcaaatattgaatcaatgtcattgtcatgtcatggaccct 48606872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University