View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2807_high_8 (Length: 369)
Name: NF2807_high_8
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2807_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 2236973 - 2237119
Alignment:
| Q |
1 |
tctaaatatcgttacaagttgcaacaatagcttcttttccagtttggtgaaaatgaattagctcgcaaaaataatagttgggtcaaagcagcactcgtcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2236973 |
tctaaatatcgttacaagttgcaacaatagcttcttttccagtttggtgaaaatgcattagctcgcaaaaataatagttgggtcacagcagcactcgtcc |
2237072 |
T |
 |
| Q |
101 |
aagaggcaaacgcaacaaaaaactgctaggctgcatataattgggag |
147 |
Q |
| |
|
||||||||| |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
2237073 |
aagaggcaacagcaacacaaagctgctaggctgcatataattgggag |
2237119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 254 - 350
Target Start/End: Original strand, 2237237 - 2237329
Alignment:
| Q |
254 |
gaaggaaggaaattaatgatatttgttgcttcataacaagccaccctatatagtgtataattgcttaccatccctcaagaaaacccggctctctttt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2237237 |
gaaggaaggaaattaatgatatttgttgcttcataacaagcc----tatatagtgtataattgcttaccatccctcaagaaaacccggctctctttt |
2237329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University