View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2807_low_14 (Length: 307)
Name: NF2807_low_14
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2807_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 17 - 295
Target Start/End: Complemental strand, 39279331 - 39279053
Alignment:
| Q |
17 |
actctttaggtggggctcttttaaaaccaggatccgttgtgaatcctgttggtagagccccaccaaatccagaggctgagccactcacggtcataacccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39279331 |
actctttaggtggggctcttttaaaaccagaatccgctgtgaatcctgttggtagagccccaccaaatccagaggcggagccactcacggtcataacccg |
39279232 |
T |
|
| Q |
117 |
tgagttggccaaacccaacatcatatttacatatgcatctcttgcccttagcaacatcttcttaggggaagggattctgattcttttgattcggatctta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39279231 |
tgagttggccaaacccaacatcatatttacatatgcatctcttgccctaagcaacatcttcttaggggaagggattctgattctgttgattcggatctta |
39279132 |
T |
|
| Q |
217 |
ggtgatagtttgatcttccacctccaaaatcgaccttttcgggtttgagtgcttccaagttcaactttgcttgttcttc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39279131 |
ggtgatagtttgatcttccacctccaaaatcgaccttttcgggtttgagtgcttccaagttcaactttgcttgttcttc |
39279053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University