View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2807_low_22 (Length: 244)
Name: NF2807_low_22
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2807_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 50764592 - 50764808
Alignment:
| Q |
18 |
agacaaattcagaatgagatccatgctaaaagttttcttcaaattagatgttggtgaagcaatttgagaggcttatcaagttgttttctatcactttgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50764592 |
agacaaattcagaatgagatccatgctaaaagttttcttcaaattagatgttggtgaagcaatttgagaggcttatcaagttgttttctatcactttgat |
50764691 |
T |
|
| Q |
118 |
tcatttagggttttctttggtcattcttagcttattgtcaaatgtttcttggcttatttccatagttgcaactggttgctgcttctgttatgtcatcgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50764692 |
tcatttagggttttctttggtcattcttagcttattgtcaaatgtttcttggcttatttccatagttgcaactggttgctgcttctgttatgtcatcgtg |
50764791 |
T |
|
| Q |
218 |
cagctttattctctgtg |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
50764792 |
cagctttattctctgtg |
50764808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 35153505 - 35153576
Alignment:
| Q |
19 |
gacaaattcagaatgagatccatgctaaaagttttcttcaaattagatg---ttggtgaagcaatttgagagg |
88 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
35153505 |
gacaaattcagaatgaga-ccatgcttaaagttttcttcaaataagatgttattggtgaagcaatttgagagg |
35153576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University