View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2807_low_28 (Length: 236)
Name: NF2807_low_28
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2807_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 2125728 - 2125563
Alignment:
| Q |
1 |
tgttgtagcgctcaataacagatttcatactgccataatgtagatatcagtaaaaaatgattagcaactattgatgattattacccctc--nnnnnnnnc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| | |
|
|
| T |
2125728 |
tgttgtagcgctcaataacagatttcatactgccataatgtagatatcagtaaaaaatgattagcaactatt--tgatgattacccctcaaaaaaaaaac |
2125631 |
T |
|
| Q |
99 |
tatcgatgttcctttttctgtttgcatatttaatttcctccaagttacttaatttatttcagttccattcattgaaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2125630 |
tatcgatgttcctttttctgtttgcat-----atttcctccaag----ttaatttatttcagttccattcattgaaa |
2125563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 2125349 - 2125304
Alignment:
| Q |
173 |
aaagagttcctccgtgaacgagggaggtggttgctttttgtaatgttatt |
222 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2125349 |
aaagagttcctccgtgaacgagg----tggttgctttttgtaatgttatt |
2125304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University