View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2807_low_30 (Length: 222)
Name: NF2807_low_30
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2807_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 4 - 186
Target Start/End: Complemental strand, 37179542 - 37179361
Alignment:
| Q |
4 |
aatttataatacagatattgaattacacatttggatacaactatcatgacttctttcttcatttaattagccctgttattattgttaacgatatagggtt |
103 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37179542 |
aatttataataca-atattgaattacatatttggatacaactatcatgacttctttctttatttaattagccctgttattattgttaacgatatagggtt |
37179444 |
T |
|
| Q |
104 |
ttaatagagaatgatatagggcttcaatacagaataaaaagacggctaggttttcaatatggttaacaatgacataacatata |
186 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||| |
|
|
| T |
37179443 |
ttaatagagaatgatatagggtttcaatacagaataaaaagacggctaggttttcaatatgattaacaacggcataacatata |
37179361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University