View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2807_low_30 (Length: 222)

Name: NF2807_low_30
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2807_low_30
NF2807_low_30
[»] chr4 (1 HSPs)
chr4 (4-186)||(37179361-37179542)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 4 - 186
Target Start/End: Complemental strand, 37179542 - 37179361
Alignment:
4 aatttataatacagatattgaattacacatttggatacaactatcatgacttctttcttcatttaattagccctgttattattgttaacgatatagggtt 103  Q
    ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
37179542 aatttataataca-atattgaattacatatttggatacaactatcatgacttctttctttatttaattagccctgttattattgttaacgatatagggtt 37179444  T
104 ttaatagagaatgatatagggcttcaatacagaataaaaagacggctaggttttcaatatggttaacaatgacataacatata 186  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||    
37179443 ttaatagagaatgatatagggtttcaatacagaataaaaagacggctaggttttcaatatgattaacaacggcataacatata 37179361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University