View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2807_low_31 (Length: 220)
Name: NF2807_low_31
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2807_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 42667100 - 42666913
Alignment:
| Q |
12 |
caaaggtaactaaatatgaaccaaaatgagtacatgttcttgtccactaggaaaactagtgttcttttagggtcagcttcctctatatggataaaaactt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42667100 |
caaagataactaaatatgaaccaaaatgagtacatgttcttgtccactaggaaaactagtgttcttttagggtc---ttcctctatatggataaaaactt |
42667004 |
T |
|
| Q |
112 |
gaatatcaaccacataaaaacaataatgtagtatgaatcttaacttagttaaaaacataaaactatatcaccatcatatgcatgaataatg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667003 |
gaatatcaaccacataaaaacaataatgtagtatgaatcttaacttagttaaaaacataaaactatatcaccatcatatgcatgaataatg |
42666913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University