View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2807_low_32 (Length: 216)
Name: NF2807_low_32
Description: NF2807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2807_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 32693699 - 32693890
Alignment:
| Q |
15 |
atatctactccctctagcccaactctcaattccatatccatcatatcttccatcaacccagtcaccttcatatcttccattcacaaagtaattatacaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32693699 |
atatctactccctctagcccaactctcaattccatatccatcatatcttccatcaacccaatcaccttcatatcttccattcacaaagtaattatacaca |
32693798 |
T |
 |
| Q |
115 |
ccacttccgttacttcttcctttatgaaactccccttcgtaaaaatcaccgttgctgtaaaactctacaccttcttttatcttcttcttctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32693799 |
ccacttccgttacttcttcctttatgaaactccccttcgtaaaaatcaccgttgctgtaaaactctacaccttcttttatcttctttttctc |
32693890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 15 - 176
Target Start/End: Original strand, 24238965 - 24239126
Alignment:
| Q |
15 |
atatctactccctctagcccaactctcaattccatatccatcatatcttccatcaacccagtcaccttcatatcttccattcacaaagtaattatacaca |
114 |
Q |
| |
|
||||||||| || |||||||| || ||||||||||| ||||||||| ||||||||||||| |||||||||||||||||| ||||| | |||| ||| || |
|
|
| T |
24238965 |
atatctacttcccctagcccagctttcaattccataaccatcatattttccatcaacccaatcaccttcatatcttccactcacataataatgataaact |
24239064 |
T |
 |
| Q |
115 |
ccacttccgttacttcttcctttatgaaactccccttcgtaaaaatcaccgttgctgtaaaa |
176 |
Q |
| |
|
|||||||| |||| |||| ||||| || |||||||| |||||||| ||||||||||| |
|
|
| T |
24239065 |
ccacttccattacactttccaccgtgaaattctccttcgtagaaatcaccattgctgtaaaa |
24239126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University