View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2808_high_16 (Length: 228)
Name: NF2808_high_16
Description: NF2808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2808_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 38612557 - 38612341
Alignment:
| Q |
1 |
ccatgggttctggttcaggttcaggttcaggttccggcgctggtgcttgcgcttg------agcttcaacgtcgcctccagactttcggaagatctgatc |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612557 |
ccatgggttctggttctggttcaggttcaggttccggcgctggtgcttgcgcttgcgcttgagcttcaacgtcgcctccagactttcggaagatctgatc |
38612458 |
T |
 |
| Q |
95 |
gatgcggcgagtaccacccggaacggatttaggccgttccacaaccgccgctggtttatcagatttcacagtttcagacggcaccggaagcgaatcgagt |
194 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612457 |
gatgcggcgagtaccaaccgaaacggatttaggccgatccacaaccgccgctggtttatcagatttcacagtttcagacggcaccggaagcgaatcgagt |
38612358 |
T |
 |
| Q |
195 |
agaaaatcacttattgg |
211 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38612357 |
agaaaatcacttattgg |
38612341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University