View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2808_low_10 (Length: 324)
Name: NF2808_low_10
Description: NF2808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2808_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 5955308 - 5955004
Alignment:
| Q |
18 |
gtttagaggagcaacagaagggtttaaggaacttggttattcaaggaacgatcctgtttttgcaatgcgcggatcgatgcattcgattcaaagagatatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955308 |
gtttagaggagcaacagaagggtttaaggaacttggttattcaaggaacgatcctgtttttgcaatgcgcggatcgatgcattcgattcaaagagatatg |
5955209 |
T |
 |
| Q |
118 |
atcatgctagaaaatcagcttccccttttcatactagatttgcttctgggaattcagattggtaaaccagatttaaaaggacttgttgcaaatctagcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5955208 |
atcatgctagaaaatcagcttccccttttcatactagatttgcttctgggaattcagattggtaaaccagatttgaaaggacttgttgcaaatctagcac |
5955109 |
T |
 |
| Q |
218 |
tcagattcttcgaccctttaatgccaacagatgaaccattaacaaaaagtgatagaaataaactggaatcaacatttagaaaaagcactaccaacgccac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5955108 |
tcagattcttcgaccctttaatgccaacagatgaaccattaacaaaaagtgatagaaataaactggaatcaacatttagaaaaagcactaccaatgccac |
5955009 |
T |
 |
| Q |
318 |
ctttg |
322 |
Q |
| |
|
||||| |
|
|
| T |
5955008 |
ctttg |
5955004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University