View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2808_low_14 (Length: 280)
Name: NF2808_low_14
Description: NF2808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2808_low_14 |
 | |
|
| [»] chr6 (4 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 268; Significance: 1e-150; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 24107565 - 24107286
Alignment:
| Q |
1 |
agcgggagacataaacgtgaatcctccaccgtggaagaaaattaccacgggaagggatgtggttttggtgttactacctcctccggcgccggcattgacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| | |
|
|
| T |
24107565 |
agcgggagacataaacgtgaatcctccaccgtggaagaaaattaccacgggaagggatgtggtttcggtgttactacctcctccggcgctggcattgatg |
24107466 |
T |
|
| Q |
101 |
ccggtgggagtgaagagacggaaccaaattttactttcggcatcaacagttatgtcttttgtggaaacaccgttaatgggagttgctttagccgatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24107465 |
ccggtgggagtgaagagacggaaccaaattttactttcggcatcaacagttatgtcttttgtggaaacaccgttaatgggagttgctttagccgatgttt |
24107366 |
T |
|
| Q |
201 |
tgttatctaaaaagttgagaagacggcggttaacactaccattagatcgacatgcagcgtccgttaaagtcataatcaat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24107365 |
tgttatctaaaaagttgagaagacggcggttaacactaccattagatcgacatgcagcgtccgttaaagtcataatcaat |
24107286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 183
Target Start/End: Complemental strand, 24151865 - 24151784
Alignment:
| Q |
102 |
cggtgggagtgaagagacggaaccaaattttactttcggcatcaacagttatgtcttttgtggaaacaccgttaatgggagt |
183 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| |||||| | ||| || |||||||| |||||||| ||||||| |||||| |
|
|
| T |
24151865 |
cggtgggagtgaagagacgaaaccaaacgttattttcggtgttaacggtaatgtctttggtggaaacgccgttaacgggagt |
24151784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 24189031 - 24188978
Alignment:
| Q |
17 |
gtgaatcctccaccgtggaagaaaattaccacgggaagggatgtggttttggtg |
70 |
Q |
| |
|
||||| || ||||||||||||||||| || ||||||||||| || ||||||||| |
|
|
| T |
24189031 |
gtgaagccaccaccgtggaagaaaatgacgacgggaagggaggtagttttggtg |
24188978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 24168789 - 24168737
Alignment:
| Q |
17 |
gtgaatcctccaccgtggaagaaaattaccacgggaagggatgtggttttggt |
69 |
Q |
| |
|
||||| || ||||||||||||||||| || ||||||||||| || |||||||| |
|
|
| T |
24168789 |
gtgaagccaccaccgtggaagaaaatgacaacgggaagggaggttgttttggt |
24168737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University