View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2808_low_21 (Length: 201)
Name: NF2808_low_21
Description: NF2808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2808_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 16 - 126
Target Start/End: Original strand, 28404535 - 28404645
Alignment:
| Q |
16 |
cacaaacacaccctcttctcttccttaaacatccatgacactacaacctcatctctctcctcaaaaacccaaaaccaaacatgcatattccatttaaacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28404535 |
cacaaacacaccctcttctcttccttaaacatccatgacactacaacctcatctctctcctcaaaaacccaaaaccaaacatgcatattccatttaaacc |
28404634 |
T |
|
| Q |
116 |
actcttattca |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
28404635 |
actcttattca |
28404645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 148 - 188
Target Start/End: Original strand, 28404667 - 28404707
Alignment:
| Q |
148 |
atggtactaattcttttggaaccatgggaccaatctctgct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28404667 |
atggtactaattcttttggaaccatgggaccaatctctgct |
28404707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University