View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2808_low_8 (Length: 349)
Name: NF2808_low_8
Description: NF2808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2808_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 73 - 343
Target Start/End: Complemental strand, 7976240 - 7975970
Alignment:
| Q |
73 |
ataaaaatatcaggaaatgaggcagctttgcaccaagatggcggtgaatcatgtgatgcaactttattttatcaaattaaaatgttccattgttgataga |
172 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7976240 |
ataaaaatatcaggaagtgaggcagctttgctccaagatggcggtgaatcacgtgatgcaactttattttatcaaattaaaatgttccgttgttgataga |
7976141 |
T |
|
| Q |
173 |
tatggataatgtaaaggtcaagactccttgatattttgaaccagtgtcccacattatttttcaagatcaatgaattaacatatgcataagaaaaccactc |
272 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7976140 |
tatggacaatgtaaaggtcaagactccttgatattttgaaccagtgtcccacgttatttttcaagatcaatgaattaacatatgcataagaaaaccactc |
7976041 |
T |
|
| Q |
273 |
gtaaggtaacatctcaaataaacacaacttgcccacttggtcttaaagccaactacctaaccctttgcttc |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7976040 |
gtaaggtaacatctcaaataaacacaacttgcccacttggtcttaaagccaactacctaaccctttgcttc |
7975970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University