View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2808_low_9 (Length: 329)
Name: NF2808_low_9
Description: NF2808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2808_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 13 - 315
Target Start/End: Complemental strand, 37203995 - 37203693
Alignment:
| Q |
13 |
ggacatcatctatttgtagcaccataaatgttgcatttaatccaatgatttaaaggaggccgccatacaacttctttaatcctaggcacaataggaggat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37203995 |
ggacatcatctatttgtagcaccataaatgttgcatttaatccaatcatttaaaggaggccgccataaaacttctttaatcctaggcacaataggaggat |
37203896 |
T |
|
| Q |
113 |
gaatgttcgtcggtcgagaaggccttcaaaatatggacacccttaatagaggatgtggtagttgttagagcaagaattattgtcacacatcatcgtatta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
37203895 |
gaatgttcgtcggtcgagaaggccttcaaaatatggacacccttaatagaggatgtggtagttgttagagcaggtattattgtcacacatcatcgtatta |
37203796 |
T |
|
| Q |
213 |
caaattttacggcaatttaatatctcgattattcttctcaaccacactacttggcaaacacacgatgcagcaattgtaaattctgcttcagtggtagaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37203795 |
caaattttacggcaatttaatatctcgattattcttctcaaccacgctacttggcaaacacacgatgcagcaactgtaaattctgcttcagtggtagaaa |
37203696 |
T |
|
| Q |
313 |
gtg |
315 |
Q |
| |
|
||| |
|
|
| T |
37203695 |
gtg |
37203693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University