View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2809_high_5 (Length: 348)
Name: NF2809_high_5
Description: NF2809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2809_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 139 - 329
Target Start/End: Complemental strand, 7065927 - 7065737
Alignment:
| Q |
139 |
gggaaagggtgtagtatttggaggaaaaggagtgaggaaaagatcctatgtagcaccagcacttcaaatcaaatgtatatgaggtgtttgacacttgttg |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7065927 |
gggaaagtgtgtagtatttggaggaaaaggagtgaggaaaagatcctatgtagcaccagcacttcgaatcaaatgtatatgaggtgtttgacacttgttg |
7065828 |
T |
 |
| Q |
239 |
gggtctgacattaacatattggatcatatgatgcattcaatcacttctatttcttgaattcggtgtcgatgtcaatgtatacggtaactgt |
329 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
7065827 |
gggtctgacattgacatattggatcatatgatgcattcaatcacttctatttcttgaattcggtgtcgatgtcaatgtattcagtaactgt |
7065737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 7066129 - 7065987
Alignment:
| Q |
1 |
tttatgatttgtaatttgaattcagagactaggggtatggttttgtgcttttatgatttgtagtttgaaagaatggatttacttgtgtttttcgtttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7066129 |
tttatgatttgtaatttgaattcagagactgggggtatggttttgtgcttttatgatttgtagtttgaaagaatggatttacttgtgtttttcctttcta |
7066030 |
T |
 |
| Q |
101 |
gaaatgcatgcttatgagtgtttgcgtggaaattgggagggaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7066029 |
gaaatgcatgcttatgagtgtttgcgtggaaattgggagggaa |
7065987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University