View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2809_low_11 (Length: 237)
Name: NF2809_low_11
Description: NF2809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2809_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 218
Target Start/End: Complemental strand, 25969021 - 25968814
Alignment:
| Q |
11 |
ggagcagagacatacccaagagacgcaacaacaatgcagacacatttgaaaatcggaaagattcattgaagatcaaccgattcacaagaaattttcgcca |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25969021 |
ggagcagaaacatacccaagagacgcaacaacaatgcagatacatttgaaaatcggaaagattcattgaagaccaaccgattcacaagaaattttcgcca |
25968922 |
T |
 |
| Q |
111 |
gtttaattactctaagaggaggtttaccgacaccaaaagtatctctgccccgtttacgccccacaacacgacatcgttcataatccgtgcgaagaagtct |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25968921 |
gtttaactactctaagaggaggtttaccgacaccaaaagtatctctgccccgtttacaccccacaacacgacatcgttcataatccgtgcgaagaagtct |
25968822 |
T |
 |
| Q |
211 |
ggcgggat |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
25968821 |
ggcgggat |
25968814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University