View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_high_25 (Length: 401)
Name: NF2810_high_25
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Complemental strand, 6020580 - 6020194
Alignment:
| Q |
1 |
atgaaggaggaattggtgttggaccttcaataatttgatcctcgtcagtttgtgcacttaacctttcaccatcttgctcctctcttaaccaaaagaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6020580 |
atgaaggaggaattggtgttggaccttcaataatttgatcctcgtcagtttgtgcacttaacctttcaccatcttgctcctctcttaaccaaaagaatgg |
6020481 |
T |
|
| Q |
101 |
ttctttcacctgatcccttttttcacttccaattgcacttacatttctcttaattgaagcctcttgtgttccctctttgttaacttgagtgatagagcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6020480 |
ttctttcacctgatcccttttttcacttccaattgcacttacatttctcttaattgaagcctcttgtgttccctctttgttaacttgagtaatagagcct |
6020381 |
T |
|
| Q |
201 |
cctgtcttcaaattccttagtggagtttccgaaagaatgtcttgtggaacctgaacccgtttcttagccggaaaagaaggctttgcacggttagaagccg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6020380 |
cctgtcttcaaattccttagtggagtttccgaaagaatgtcttgtggaacctgaacccttttcttagccggaaaagaaggctttgcacggttagaagccg |
6020281 |
T |
|
| Q |
301 |
gacttttcctgctagtctttagcttctccgagcttattgtgcttgtcttaagtttcttcctggacctctttcttgtgggtgtttttt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6020280 |
gacttttcctgctagtctttagcttctccgagcttattgtgcttgtcttaagtttcttcctggacctctttcttgtgggtgtttttt |
6020194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University