View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_high_28 (Length: 382)
Name: NF2810_high_28
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 12 - 364
Target Start/End: Complemental strand, 34800347 - 34799995
Alignment:
| Q |
12 |
atgaacaccaatagcaagtagaaaaatggtaacgagtccaaagaagatgatggtatggaccaagatagagagaccgctagtttgcatgctcccaaaagcc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34800347 |
atgaacaccaatagcaagtagaaaaatggtaacgagtccaaagaagatgatggtatggaccaagatagagagaccactagtttgcatgctcccaaaagcc |
34800248 |
T |
 |
| Q |
112 |
accaccctccccttagccgggagctggaacagtagccctgggctcagtagcacaaacagcaccactgatacaaccaccggagcccaatcagcagccatca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34800247 |
accaccctccccttagccgggagctggaacagtagccctgggctcagtagcacaaacagcaccactgatacaaccaccggagcccaatcagcagccatca |
34800148 |
T |
 |
| Q |
212 |
ctttgcacaaattgctattcttttctaacaaaattaaattaattgctgatacaataatacacaatctgctatgtgacccctttgtaagcttgttaaatag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34800147 |
ctttgcacaaattgctattcttttctaacaaaattaaattaattgctgatacaataatacacaatctgctatgtgacccctttgtaagcttgttaaatag |
34800048 |
T |
 |
| Q |
312 |
gaacgaaaaggtgattctgatctatgtgtgaggcaattgattgaggctgatgg |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34800047 |
gaacgaaaaggtgattctgatctatgtgtgaggcaattgattgaggctgatgg |
34799995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 38418908 - 38418993
Alignment:
| Q |
31 |
agaaaaatggtaacgagtccaaagaagatgatggtatggaccaagatagagagaccgctagtttgcatgctcccaaaagccaccac |
116 |
Q |
| |
|
||||| ||||||| ||||||||| |||| ||||||||||||||| ||||| | ||| || ||||||||| ||||||| ||||||| |
|
|
| T |
38418908 |
agaaagatggtaatgagtccaaaaaagaggatggtatggaccaaaatagacacaccactggtttgcatgttcccaaactccaccac |
38418993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University