View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_high_33 (Length: 347)
Name: NF2810_high_33
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 208 - 339
Target Start/End: Original strand, 20994193 - 20994324
Alignment:
| Q |
208 |
gttgaaaatgaaaatattaaaatcacctttggatgctttgtggtgatgcatgtactgcctttctgaatctcttaggtctctttgttagtgtttcccaata |
307 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20994193 |
gttgaaaatgaaaatattaaaatcacttttggatgctttgtggtgatgcatgtactgcctttctgaatctcttaggtctctttgttagtgtttcccaata |
20994292 |
T |
|
| Q |
308 |
tttgggtcactatgtctctttatatttcttct |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20994293 |
tttgggtcactatgtctctttatatttcttct |
20994324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 20993979 - 20994099
Alignment:
| Q |
1 |
aaaaagagaggaaggaagactaaaaacgcaaggactagaccgatctcatgctcttttgaccttccnnnnnnnnngttatgacgaaagcattggcattgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
20993979 |
aaaaagagaggaaggaagactaaaaacgcaaggactagaccgatctcatgctcttttgaccttcc-ttttttttgttatgatgaaagcattggcattgaa |
20994077 |
T |
|
| Q |
101 |
agggtaagcatggaactaaaga |
122 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
20994078 |
agggtaagcatgatactaaaga |
20994099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 65
Target Start/End: Complemental strand, 4525888 - 4525827
Alignment:
| Q |
4 |
aagagaggaaggaagactaaaaacgcaaggactagaccgatctcatgctcttttgaccttcc |
65 |
Q |
| |
|
||||||||||| |||||||||||| |||| | ||||||||||||| |||||||| ||||| |
|
|
| T |
4525888 |
aagagaggaagaaagactaaaaacattaggattggaccgatctcatgttcttttgagcttcc |
4525827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University