View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_high_74 (Length: 236)
Name: NF2810_high_74
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_high_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 31928259 - 31928398
Alignment:
| Q |
1 |
acttgatgaataagtagcttccctcagttgtaggaaagggtgaccaaaccatgagagacgaaccctaataattccccataaaaaggagacttatggctaa |
100 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||||||||||| ||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31928259 |
acttgaggaataagtagctgccctcaattgtaggaaagggcgaccaaaccatgaaagacaaaccctaatacttccccataaaaaggagacttatggctaa |
31928358 |
T |
 |
| Q |
101 |
accttaattcattaac--tctaacccaaaatacctaaata |
138 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||||| |
|
|
| T |
31928359 |
accttaattcattcactttctaccccaaaatacctaaata |
31928398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University