View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2810_high_74 (Length: 236)

Name: NF2810_high_74
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2810_high_74
NF2810_high_74
[»] chr8 (1 HSPs)
chr8 (1-138)||(31928259-31928398)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 31928259 - 31928398
Alignment:
1 acttgatgaataagtagcttccctcagttgtaggaaagggtgaccaaaccatgagagacgaaccctaataattccccataaaaaggagacttatggctaa 100  Q
    |||||| |||||||||||| |||||| ||||||||||||| ||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||    
31928259 acttgaggaataagtagctgccctcaattgtaggaaagggcgaccaaaccatgaaagacaaaccctaatacttccccataaaaaggagacttatggctaa 31928358  T
101 accttaattcattaac--tctaacccaaaatacctaaata 138  Q
    ||||||||||||| ||  |||| |||||||||||||||||    
31928359 accttaattcattcactttctaccccaaaatacctaaata 31928398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University