View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_low_56 (Length: 274)
Name: NF2810_low_56
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 52369458 - 52369211
Alignment:
| Q |
16 |
ataattttgtgcagatttgtgggacattatatttatgggggtgtctgttactgatttgtcaaataatgggtccaataagatgagtacttcaagcaggttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52369458 |
ataattttgtgcagatttgtgggacattatatttatgggggtgtctgttactgatttgtcaaat---gggtccaataagatgagtacttcaagcaggttg |
52369362 |
T |
 |
| Q |
116 |
agtgattgcagacctcaacacatgattcttgaaagaaaccattcatttgttcaagataaagaacaaaacatggattcatccaaaagtgatcaattgaaac |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
52369361 |
agtgattgcagacctcaacatatgattcttgaaagaaaccattcatttgttcaagataaagaacagaacatggattcaaccaaaagtgatcaattgaaac |
52369262 |
T |
 |
| Q |
216 |
ataaacaagttccagtgatttctctgcctgaagcacttgttttttcttctc |
266 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369261 |
ataaacaagttccattgatttctctgcctgaagcacttgttttttcttctc |
52369211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University