View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_low_65 (Length: 250)
Name: NF2810_low_65
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_low_65 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 2 - 250
Target Start/End: Original strand, 9645297 - 9645545
Alignment:
| Q |
2 |
gtgaaggagcaaagggatagtcatatgcactcatttagatagttagcatttcattttcgtttcattgtaatttcaatttcataagttactactttctgtt |
101 |
Q |
| |
|
|||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9645297 |
gtgaagaaacaaaaggatagtcatatgcactcatttagatagttagcatttcattttcgtttcattgtaatttcaatttcataagttactactttctgtt |
9645396 |
T |
|
| Q |
102 |
ggacaatttttgttgccatgtagtgttacctccatatatatagcttcactttataaactcttaattcgttcagaacaccaagtagataaattgaatacca |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9645397 |
ggacaatttttgttgtcatgtagtgttaccttcatatatatagcttcactctataaactcttaattcgttcagaacaccaagtagataaattgaatacca |
9645496 |
T |
|
| Q |
202 |
ctcagagaaattttcatataacacatttgtatacaatttgtcaattgat |
250 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9645497 |
ctcaaagaaattttcatataacacatttgtatacaatttgtcaattgat |
9645545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University