View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_low_66 (Length: 250)
Name: NF2810_low_66
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_low_66 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 6 - 222
Target Start/End: Original strand, 2125899 - 2126116
Alignment:
| Q |
6 |
atccaaaccatcaccatgttgtaattatgggagtgtagaaactaggtcattatatcattaacagatttatggggtggttggnnnnnnnnn-cataaacac |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
2125899 |
atccaaaccatcaccatgttataattattggagtgtagaaactaggtcattataacattaacacatttatggggtggttggaaaaaaaaaacataaacac |
2125998 |
T |
|
| Q |
105 |
atgtaaaacattgcttgtagtatcttatttcaatccatcaatttatctatatccttttgttgttgtgttttacttacaagaacttttattttggtgttat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2125999 |
atgtaaaacattgcttgtagtatcttatttcaatccatcaatttatctatatccttttgttgttgtgttttacttacaagaacttttattttggtgttat |
2126098 |
T |
|
| Q |
205 |
gttagtctgtatgttgtc |
222 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
2126099 |
gttagtctgcatgttgtc |
2126116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University