View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_low_78 (Length: 238)
Name: NF2810_low_78
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 76 - 230
Target Start/End: Original strand, 12631476 - 12631630
Alignment:
| Q |
76 |
gacataaacttccttcttcctttaaaatgttatgagtttatttgatttaagaaaagaaaatgatttcacaatgattttgaacagttttttagagcagaat |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12631476 |
gacataaacttccttcttcctttaaaatgttatgagtttatttgatttaagaaaagaaaaagatttcacaatgattttgaacagttttttagagcagaat |
12631575 |
T |
 |
| Q |
176 |
tacaatttgtgttacaatttgttttagagcacaaggtgaaaggaactgatgatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12631576 |
tacaatttgtgttacaatttgttttagagcacaaggtgaaaggaactgataatgt |
12631630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University