View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2810_low_80 (Length: 237)

Name: NF2810_low_80
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2810_low_80
NF2810_low_80
[»] chr7 (1 HSPs)
chr7 (18-157)||(45900427-45900566)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 45900566 - 45900427
Alignment:
18 tgatctttgtatgaactgtgaactcaaaatctaaactcagcttttaagttgagatatcttcagcgtgtcaaacactgttgacggttatggatagactctc 117  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45900566 tgatccttgtatgaactgtgaactcaaaatctaaactcagcttttaagttgagatatcttcagcgtgtcaaacactgttgacggttatggatagactctc 45900467  T
118 ttcaaattaaagttaactccttcaacaaatttaggctctc 157  Q
    ||||||||||||||||||||||||||||||||||||||||    
45900466 ttcaaattaaagttaactccttcaacaaatttaggctctc 45900427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University