View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_low_87 (Length: 233)
Name: NF2810_low_87
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_low_87 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 34650536 - 34650753
Alignment:
| Q |
1 |
cgttctaccatgaatatcaaggaaaaacaacaacctctttttgtaaacatgaacctatcatgtgtgcatgcatctatagtaactaacaatgcttgttttt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34650536 |
cgttctaccatgaatatcagggaaaaacaacaacctctttttgtaaaaatgatcctatcatgtgtgcatgcatctatagtaactaacaatgcttgttttt |
34650635 |
T |
 |
| Q |
101 |
tattctgatttttggacattattatactaacatgtaactggtaataagttctttgtcaacagaagaaaaccttgaaacttgacatgcatgcaatttgatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34650636 |
tattctgatttttggacattattatactaacatgtaactggtaataagttctttgtcaacagaagaagaccttgaaacttgacatgcatgcaatttgatt |
34650735 |
T |
 |
| Q |
201 |
cttatgttactttattct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34650736 |
cttatgttactttattct |
34650753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University