View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_low_91 (Length: 224)
Name: NF2810_low_91
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_low_91 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 25 - 205
Target Start/End: Original strand, 28594689 - 28594872
Alignment:
| Q |
25 |
ttgaaaagtactaaa---taagtgtccatgatgaactggcattgttaaccaaaggagaactggtcactataatatattgtcaaaaccaaaatattaaagc |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28594689 |
ttgaaaagtactaaaacataagtgtccatgatgaactggcattgttaaccaaaggagaactggtcactataatatattgtcaaaaccaaaatattaaagc |
28594788 |
T |
|
| Q |
122 |
tttcatcttaatttatcatcaatgaaccgcgttgcaacttgcagcggccatcattagtgaccatgaaatattctcaatattctc |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28594789 |
tttcatctaaatttatcatcaatgaaccgcgttgcaacttgcagcggccatcattagtgaccatgaaatattctcaatattctc |
28594872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 39 - 97
Target Start/End: Original strand, 32492944 - 32493006
Alignment:
| Q |
39 |
ataagtgtccatgatgaactggcattgttaacca----aaggagaactggtcactataatata |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
32492944 |
ataagtgtccatgatgaactggcattgtcaaccatattaaggagaactggtcactataatata |
32493006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University