View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2810_low_95 (Length: 214)
Name: NF2810_low_95
Description: NF2810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2810_low_95 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 32805172 - 32805375
Alignment:
| Q |
1 |
ctcaacattccgggaggaggtctcagtggtgatgctactgttgcggaattaattgatagggatacaaatcagtgggaccggggtcttatttttagcaggt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32805172 |
ctcaacaatccgggaggaggtctcagtggtgatgctactgttgcagaattaattgatagggatacaaatcagtgggaccggggtcttatttttagcaggt |
32805271 |
T |
|
| Q |
101 |
tcaacaactacacagccaggaaaatcataagcatccctttatctgttaggcgtccaacagacaaaatcatatggcattgggaaaagaatggtgtctactc |
200 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32805272 |
tcaataactacatagccaggaaaatcataagcatccctttatctgttaggcgtccaacagacaaaatcatatggcattgggaaaagaatggtgtctactc |
32805371 |
T |
|
| Q |
201 |
tgtg |
204 |
Q |
| |
|
|||| |
|
|
| T |
32805372 |
tgtg |
32805375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 6095745 - 6095542
Alignment:
| Q |
1 |
ctcaacattccgggaggaggtctcagtggtgatgctactgttgcggaattaattgatagggatacaaatcagtgggaccggggtcttatttttagcaggt |
100 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6095745 |
ctcaacaatccgggaggaggtcttagtggtgatgctactattgcggaattaattgatagggatacaaatcagtgggaccggggtcttatttttagtaggt |
6095646 |
T |
|
| Q |
101 |
tcaacaactacacagccaggaaaatcataagcatccctttatctgttaggcgtccaacagacaaaatcatatggcattgggaaaagaatggtgtctactc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6095645 |
tcaacaactacacagccaggaaaatcataagcatccctttatctgttaggcgtccaacagacaaaatcatatggcattgggaaaagaatggtgtctactc |
6095546 |
T |
|
| Q |
201 |
tgtg |
204 |
Q |
| |
|
|||| |
|
|
| T |
6095545 |
tgtg |
6095542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University