View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2811R-Insertion-17 (Length: 160)
Name: NF2811R-Insertion-17
Description: NF2811R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2811R-Insertion-17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 2e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 28924585 - 28924737
Alignment:
| Q |
8 |
agaattgaaatacgtattcgaacggtgttcatgaggagaagatgtgaacgttgattccgtaaccaattcaggactccaatgtaccgatttcttcatgcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28924585 |
agaattgaaatacgtattcgaacggtgttcatgaggagaagatgtgaacgttgattccgtaaccaattcaggactccaatgtaccgatttcttcatgcta |
28924684 |
T |
|
| Q |
108 |
ccgggcgatggttccgtgcctagcggttccgatccagatccggatccggctcc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28924685 |
ccgggcgatggttccgtgcctagcggttccgatccagatccggatccggctcc |
28924737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 2e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 55 - 159
Target Start/End: Original strand, 25230536 - 25230640
Alignment:
| Q |
55 |
acgttgattccgtaaccaattcaggactccaatgtaccgatttcttcatgctaccgggcgatggttccgtgcctagcggttccgatccagatccggatcc |
154 |
Q |
| |
|
||||||||| ||| |||||||| |||||| |||||| |||||||||| |||||| | ||||| || ||||||| | ||||||||||| ||||||||||| |
|
|
| T |
25230536 |
acgttgatttcgtgaccaattccggactctaatgtattgatttcttcacgctacctgacgatgatttcgtgcctggtggttccgatccggatccggatcc |
25230635 |
T |
|
| Q |
155 |
ggctc |
159 |
Q |
| |
|
||||| |
|
|
| T |
25230636 |
ggctc |
25230640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University